Transcript: Human XM_017021128.1

PREDICTED: Homo sapiens zinc finger FYVE-type containing 26 (ZFYVE26), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFYVE26 (23503)
Length:
5936
CDS:
108..5327

Additional Resources:

NCBI RefSeq record:
XM_017021128.1
NBCI Gene record:
ZFYVE26 (23503)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158370 CGGCGTTTGAATAGTAGCCTT pLKO.1 678 CDS 100% 2.640 3.696 N ZFYVE26 n/a
2 TRCN0000157120 GCCCAAGTAGAGCACAAGATT pLKO.1 330 CDS 100% 5.625 4.500 N ZFYVE26 n/a
3 TRCN0000338692 TGAAACTCTTCTCCATTTAAA pLKO_005 5655 3UTR 100% 15.000 10.500 N ZFYVE26 n/a
4 TRCN0000338759 AGGTTCGGGCCTACCTGATAT pLKO_005 5122 CDS 100% 13.200 9.240 N ZFYVE26 n/a
5 TRCN0000153278 GCCCAAGCATTTCTGAACAAA pLKO.1 5634 3UTR 100% 5.625 3.938 N ZFYVE26 n/a
6 TRCN0000152294 CAGTTTATGAAGGACCAAGTT pLKO.1 4482 CDS 100% 4.950 3.465 N ZFYVE26 n/a
7 TRCN0000154083 GCCAAGATGATGTTCGTCAAA pLKO.1 3663 CDS 100% 4.950 3.465 N ZFYVE26 n/a
8 TRCN0000157654 GTGGACGATTTGAGCAGCATA pLKO.1 2007 CDS 100% 4.950 3.465 N ZFYVE26 n/a
9 TRCN0000338756 GTGGACGATTTGAGCAGCATA pLKO_005 2007 CDS 100% 4.950 3.465 N ZFYVE26 n/a
10 TRCN0000158252 CGCCAAGATGATGTTCGTCAA pLKO.1 3662 CDS 100% 4.050 2.835 N ZFYVE26 n/a
11 TRCN0000338691 CGCCAAGATGATGTTCGTCAA pLKO_005 3662 CDS 100% 4.050 2.835 N ZFYVE26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11741 pDONR223 100% 18.6% 18.2% None (many diffs) n/a
2 ccsbBroad304_11741 pLX_304 0% 18.6% 18.2% V5 (many diffs) n/a
3 TRCN0000474249 TAGCTTTCTACTTACTCCCCACTC pLX_317 38.7% 18.6% 18.2% V5 (many diffs) n/a
Download CSV