Transcript: Human XM_017021340.1

PREDICTED: Homo sapiens myosin heavy chain 7 (MYH7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYH7 (4625)
Length:
5988
CDS:
67..5874

Additional Resources:

NCBI RefSeq record:
XM_017021340.1
NBCI Gene record:
MYH7 (4625)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021340.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083311 GTACGTTGTATCATCCCTAAT pLKO.1 2074 CDS 100% 10.800 15.120 N MYH7 n/a
2 TRCN0000083308 GCGCCTATTGAGAAGGGCAAA pLKO.1 1951 CDS 100% 4.050 3.240 N MYH7 n/a
3 TRCN0000434943 ATGTCCAGCAGGTGATATATG pLKO_005 1313 CDS 100% 13.200 9.240 N MYH7 n/a
4 TRCN0000415135 AGAGACTCCCTGCTGGTAATC pLKO_005 2488 CDS 100% 10.800 7.560 N MYH7 n/a
5 TRCN0000083309 GCAGAGAGAGATTATCACATT pLKO.1 901 CDS 100% 4.950 3.465 N MYH7 n/a
6 TRCN0000083310 TGTACGTTGTATCATCCCTAA pLKO.1 2073 CDS 100% 4.050 2.835 N MYH7 n/a
7 TRCN0000083312 GTGCTCTACAACCTCAAGGAT pLKO.1 367 CDS 100% 3.000 2.100 N MYH7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021340.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15503 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15503 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466427 GTATGGACTATCGCGATATGCGCC pLX_317 6.9% 100% 100% V5 n/a
4 TRCN0000470090 CGCTCATCACTAGCCCGGCCCGTT pLX_317 6.9% 99.7% 99.6% V5 (many diffs) n/a
Download CSV