Transcript: Human XM_017021451.2

PREDICTED: Homo sapiens zinc finger protein 839 (ZNF839), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF839 (55778)
Length:
2361
CDS:
271..1926

Additional Resources:

NCBI RefSeq record:
XM_017021451.2
NBCI Gene record:
ZNF839 (55778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144960 GAGTCATTAGGAATCACAGAA pLKO.1 1588 CDS 100% 4.950 6.930 N ZNF839 n/a
2 TRCN0000121857 GACATTGTCACAGTGACTGAT pLKO.1 1873 CDS 100% 4.950 3.465 N ZNF839 n/a
3 TRCN0000141422 CACTGAATCTCTTGCTGCCAA pLKO.1 1782 CDS 100% 2.640 1.848 N ZNF839 n/a
4 TRCN0000142569 GAGGACATTGTCACAGTGACT pLKO.1 1870 CDS 100% 2.640 1.848 N ZNF839 n/a
5 TRCN0000141407 CCAGGAGACCCTGGAAATAAA pLKO.1 1551 CDS 100% 1.500 0.900 N ZNF839 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14206 pDONR223 100% 25.4% .9% None 1_1230del;1240delA;1642delG n/a
2 ccsbBroad304_14206 pLX_304 0% 25.4% .9% V5 (not translated due to prior stop codon) 1_1230del;1240delA;1642delG n/a
3 TRCN0000468366 TTAACAATGCGTTCCGCACCAGGG pLX_317 91.8% 25.4% .9% V5 (not translated due to prior stop codon) 1_1230del;1240delA;1642delG n/a
Download CSV