Transcript: Human XM_017021468.1

PREDICTED: Homo sapiens proteasome 20S subunit alpha 6 (PSMA6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSMA6 (5687)
Length:
2405
CDS:
1734..2237

Additional Resources:

NCBI RefSeq record:
XM_017021468.1
NBCI Gene record:
PSMA6 (5687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032042 CTGCAATTACATGCCTGTCTA pLKO.1 2086 CDS 100% 4.950 3.465 N Psma6 n/a
2 TRCN0000323822 CTGCAATTACATGCCTGTCTA pLKO_005 2086 CDS 100% 4.950 3.465 N Psma6 n/a
3 TRCN0000022369 GTAACAACAAACCAACATCAT pLKO.1 2288 3UTR 100% 4.950 3.465 N PSMA6 n/a
4 TRCN0000338342 GTAACAACAAACCAACATCAT pLKO_005 2288 3UTR 100% 4.950 3.465 N PSMA6 n/a
5 TRCN0000022371 GTTGTGTGATGACCGGAATGA pLKO.1 1726 5UTR 100% 4.950 3.465 N PSMA6 n/a
6 TRCN0000338339 GTTGTGTGATGACCGGAATGA pLKO_005 1726 5UTR 100% 4.950 3.465 N PSMA6 n/a
7 TRCN0000022373 GATGACCGGAATGACAGCTGA pLKO.1 1733 5UTR 100% 2.640 1.848 N PSMA6 n/a
8 TRCN0000022372 TGACCGGAATGACAGCTGACA pLKO.1 1735 CDS 100% 2.640 1.848 N PSMA6 n/a
9 TRCN0000338340 TGACCGGAATGACAGCTGACA pLKO_005 1735 CDS 100% 2.640 1.848 N PSMA6 n/a
10 TRCN0000022370 CAGGTACAGAGGGCACGCTAT pLKO.1 1764 CDS 100% 1.350 0.945 N PSMA6 n/a
11 TRCN0000338341 CAGGTACAGAGGGCACGCTAT pLKO_005 1764 CDS 100% 1.350 0.945 N PSMA6 n/a
12 TRCN0000032043 GCACGCTATGAGGCAGCTAAT pLKO.1 1776 CDS 100% 10.800 7.560 N Psma6 n/a
13 TRCN0000323820 GCACGCTATGAGGCAGCTAAT pLKO_005 1776 CDS 100% 10.800 7.560 N Psma6 n/a
14 TRCN0000091448 CCTCCCAAGTACTGGGATTAA pLKO.1 1204 5UTR 100% 1.320 0.792 N Epb42 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1331 5UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1331 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15543 pDONR223 0% 67.7% 67.8% None 0_1ins237;339A>G n/a
2 ccsbBroad304_15543 pLX_304 0% 67.7% 67.8% V5 0_1ins237;339A>G n/a
3 TRCN0000473425 ACAACTGTGCAGAGGTGGGGGGAT pLX_317 39.9% 67.7% 67.8% V5 0_1ins237;339A>G n/a
Download CSV