Transcript: Human XM_017021505.1

PREDICTED: Homo sapiens thioredoxin domain containing 16 (TXNDC16), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TXNDC16 (57544)
Length:
1931
CDS:
430..1827

Additional Resources:

NCBI RefSeq record:
XM_017021505.1
NBCI Gene record:
TXNDC16 (57544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064170 CCTATATTGATGTGGCAGTTA pLKO.1 1712 CDS 100% 4.950 6.930 N TXNDC16 n/a
2 TRCN0000064169 GCCAAGGTTAATTGTGTCAAA pLKO.1 667 CDS 100% 4.950 3.465 N TXNDC16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476741 AGGCGGAGGATTTCAAATCTTCTC pLX_317 13.6% 54.9% 54.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_08743 pDONR223 100% 54.8% 53.9% None (many diffs) n/a
3 ccsbBroad304_08743 pLX_304 0% 54.8% 53.9% V5 (many diffs) n/a
Download CSV