Transcript: Human XM_017021608.1

PREDICTED: Homo sapiens solute carrier family 8 member A3 (SLC8A3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC8A3 (6547)
Length:
4876
CDS:
381..3146

Additional Resources:

NCBI RefSeq record:
XM_017021608.1
NBCI Gene record:
SLC8A3 (6547)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044872 GCATAATTGATGACGACATTT pLKO.1 1780 CDS 100% 13.200 18.480 N SLC8A3 n/a
2 TRCN0000044869 CCTGAGATACTCCTCTCTTTA pLKO.1 816 CDS 100% 13.200 9.240 N SLC8A3 n/a
3 TRCN0000044870 CCCAAACTAGAAGTCATCATT pLKO.1 2352 CDS 100% 5.625 3.938 N SLC8A3 n/a
4 TRCN0000044871 CCAGATACGTTTGCCAGCAAA pLKO.1 2766 CDS 100% 4.950 3.465 N SLC8A3 n/a
5 TRCN0000044868 GCAGGCAATATCCTGAAGAAA pLKO.1 1473 CDS 100% 5.625 3.375 N SLC8A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06963 pDONR223 100% 30.7% 30.8% None 1_1911del;2379C>G n/a
2 ccsbBroad304_06963 pLX_304 0% 30.7% 30.8% V5 1_1911del;2379C>G n/a
3 TRCN0000475701 TTGTACCCCTCCATCTAGGCTCTG pLX_317 40.9% 30.7% 30.8% V5 1_1911del;2379C>G n/a
Download CSV