Transcript: Human XM_017021664.1

PREDICTED: Homo sapiens nucleotide binding protein like (NUBPL), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUBPL (80224)
Length:
2547
CDS:
42..635

Additional Resources:

NCBI RefSeq record:
XM_017021664.1
NBCI Gene record:
NUBPL (80224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253196 TTGGAGAGGCCTTATGGTAAT pLKO_005 506 CDS 100% 10.800 7.560 N Nubpl n/a
2 TRCN0000149874 GCTTGTATGTCTATGGGCTTT pLKO.1 459 CDS 100% 4.050 2.835 N NUBPL n/a
3 TRCN0000131136 GCAGTGAATCTTGCACTTGCA pLKO.1 294 CDS 100% 2.640 1.584 N NUBPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12686 pDONR223 100% 49.4% 43.2% None (many diffs) n/a
2 ccsbBroad304_12686 pLX_304 0% 49.4% 43.2% V5 (many diffs) n/a
3 TRCN0000492280 AAAACTATACCCAGTACGAGCCAT pLX_317 50.2% 49.4% 43.2% V5 (many diffs) n/a
Download CSV