Transcript: Human XM_017021715.2

PREDICTED: Homo sapiens zinc finger homeobox 2 (ZFHX2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFHX2 (85446)
Length:
9385
CDS:
643..8283

Additional Resources:

NCBI RefSeq record:
XM_017021715.2
NBCI Gene record:
ZFHX2 (85446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016653 GCCCAAGTTCAACCTCTTATT pLKO.1 6384 CDS 100% 13.200 9.240 N ZFHX2 n/a
2 TRCN0000016655 CCCTATTGTGATGTCAAGTAT pLKO.1 7009 CDS 100% 5.625 3.938 N ZFHX2 n/a
3 TRCN0000016656 CCAACAGCTCTATGGCATGAA pLKO.1 7677 CDS 100% 4.950 3.465 N ZFHX2 n/a
4 TRCN0000234213 TCAAAGGCTTTAAACACAGAG pLKO_005 9105 3UTR 100% 4.050 2.835 N Zfhx2 n/a
5 TRCN0000016654 GCTTCATATCTGGATTGCCTT pLKO.1 4508 CDS 100% 2.640 1.848 N ZFHX2 n/a
6 TRCN0000016657 CGCCGCTTTCTGCCCTTTGAA pLKO.1 5074 CDS 100% 1.875 1.313 N ZFHX2 n/a
7 TRCN0000234214 GGCAAATCCAAAGTTCTTTAA pLKO_005 9212 3UTR 100% 13.200 9.240 N Zfhx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12915 pDONR223 100% 15.5% 14.1% None (many diffs) n/a
2 ccsbBroad304_12915 pLX_304 0% 15.5% 14.1% V5 (many diffs) n/a
3 TRCN0000479527 AGAAGGCACGCTTCAGCCGCGCCG pLX_317 28.8% 15.5% 14.1% V5 (many diffs) n/a
Download CSV