Transcript: Human XM_017021760.2

PREDICTED: Homo sapiens nuclear export mediator factor (NEMF), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEMF (9147)
Length:
5749
CDS:
653..3196

Additional Resources:

NCBI RefSeq record:
XM_017021760.2
NBCI Gene record:
NEMF (9147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155035 GCACCCAATCTTCTGAACGTA pLKO.1 3164 CDS 100% 3.000 4.200 N NEMF n/a
2 TRCN0000127452 GCTAGGAATGAGAGTAAACAA pLKO.1 102 5UTR 100% 5.625 4.500 N Nemf n/a
3 TRCN0000150512 GCTAGGAATGAGAGTAAACAA pLKO.1 102 5UTR 100% 5.625 4.500 N NEMF n/a
4 TRCN0000326857 GCTAGGAATGAGAGTAAACAA pLKO_005 102 5UTR 100% 5.625 4.500 N Nemf n/a
5 TRCN0000152165 CAAAGATGAAAGCACCATGTA pLKO.1 3254 3UTR 100% 4.950 3.960 N NEMF n/a
6 TRCN0000151863 CGGACTTTAAAGCTACACTTT pLKO.1 170 5UTR 100% 4.950 3.960 N NEMF n/a
7 TRCN0000151913 CCAGATAGATTGGACAGAAAT pLKO.1 1078 CDS 100% 13.200 9.240 N NEMF n/a
8 TRCN0000151021 GTATCAGGATTTCCGCATTAT pLKO.1 3272 3UTR 100% 13.200 9.240 N NEMF n/a
9 TRCN0000152383 GCTGCTAAGAAATCCATACTT pLKO.1 1189 CDS 100% 5.625 3.938 N NEMF n/a
10 TRCN0000154422 GCAGCGTAAAGGACACAGATT pLKO.1 3108 CDS 100% 4.950 3.465 N NEMF n/a
11 TRCN0000152070 CTAAGAATATGATGCCGTCTA pLKO.1 236 5UTR 100% 4.050 2.835 N NEMF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.