Transcript: Human XM_017021870.2

PREDICTED: Homo sapiens cAMP regulated phosphoprotein 19 (ARPP19), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARPP19 (10776)
Length:
5135
CDS:
98..388

Additional Resources:

NCBI RefSeq record:
XM_017021870.2
NBCI Gene record:
ARPP19 (10776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158554 CCTCTCACAAATGTCTGTATT pLKO.1 1130 3UTR 100% 13.200 18.480 N ARPP19 n/a
2 TRCN0000160408 CTGGAGGTTCAGATTTCTTAA pLKO.1 177 CDS 100% 13.200 9.240 N ARPP19 n/a
3 TRCN0000344298 CTGGAGGTTCAGATTTCTTAA pLKO_005 177 CDS 100% 13.200 9.240 N ARPP19 n/a
4 TRCN0000159778 GCCACAATTTAGGACACATTT pLKO.1 4500 3UTR 100% 13.200 9.240 N ARPP19 n/a
5 TRCN0000161386 GCCTCAAACATAGCACCTTAA pLKO.1 2307 3UTR 100% 10.800 7.560 N ARPP19 n/a
6 TRCN0000161908 GATATCCTCATCTGGGACAAA pLKO.1 153 CDS 100% 4.950 3.465 N ARPP19 n/a
7 TRCN0000344219 GATATCCTCATCTGGGACAAA pLKO_005 153 CDS 100% 4.950 3.465 N ARPP19 n/a
8 TRCN0000159192 GCTCAGTTTATTGAAGACATT pLKO.1 2977 3UTR 100% 4.950 3.465 N ARPP19 n/a
9 TRCN0000162506 CTTAAGGAAACGGTTGCAGAA pLKO.1 193 CDS 100% 4.050 2.835 N ARPP19 n/a
10 TRCN0000344299 CTTAAGGAAACGGTTGCAGAA pLKO_005 193 CDS 100% 4.050 2.835 N ARPP19 n/a
11 TRCN0000159670 GATTACAACATGGCTAAAGCA pLKO.1 239 CDS 100% 3.000 2.100 N ARPP19 n/a
12 TRCN0000344300 GATTACAACATGGCTAAAGCA pLKO_005 239 CDS 100% 3.000 2.100 N ARPP19 n/a
13 TRCN0000159191 GAAATGGAAGATAAAGTGACT pLKO.1 95 5UTR 100% 2.640 1.848 N ARPP19 n/a
14 TRCN0000250795 CAAGCTGGCTGGCTGATTAAA pLKO_005 373 CDS 100% 15.000 10.500 N Arpp19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14055 pDONR223 100% 85.4% 84.9% None 0_1ins48;288_289insC n/a
2 ccsbBroad304_14055 pLX_304 0% 85.4% 84.9% V5 (not translated due to frame shift) 0_1ins48;288_289insC n/a
3 TRCN0000475757 ATTATTGTCCTGCGTTTGCATAGG pLX_317 65.2% 85.4% 84.9% V5 (not translated due to prior stop codon) 0_1ins48;288_289insC n/a
Download CSV