Transcript: Human XM_017022056.1

PREDICTED: Homo sapiens gamma-aminobutyric acid type A receptor alpha5 subunit (GABRA5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABRA5 (2558)
Length:
1241
CDS:
315..1235

Additional Resources:

NCBI RefSeq record:
XM_017022056.1
NBCI Gene record:
GABRA5 (2558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257206 GATGAAAGGCTTCGGTTTAAG pLKO_005 630 CDS 100% 13.200 18.480 N GABRA5 n/a
2 TRCN0000231859 ATGACAACATCACGATATTTA pLKO_005 442 CDS 100% 15.000 10.500 N GABRA5 n/a
3 TRCN0000189124 GCAGCTATGCGTACCCTAATT pLKO.1 889 CDS 100% 13.200 9.240 N LOC441742 n/a
4 TRCN0000061271 CACGATATTTACCAGGATCTT pLKO.1 452 CDS 100% 4.950 3.465 N GABRA5 n/a
5 TRCN0000197370 CTGAAGTCGTTTACGTCTGGA pLKO.1 910 CDS 100% 2.640 1.848 N LOC441742 n/a
6 TRCN0000061272 CATGAACTTATCCAGTCACTT pLKO.1 377 CDS 100% 4.950 2.970 N GABRA5 n/a
7 TRCN0000188829 CCCTCTGAAATTTGGCAGCTA pLKO.1 875 CDS 100% 2.640 1.584 N LOC441742 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06241 pDONR223 100% 65.1% 63.8% None (many diffs) n/a
2 ccsbBroad304_06241 pLX_304 0% 65.1% 63.8% V5 (many diffs) n/a
3 TRCN0000467210 TATTTAGCACGCAAGAGCCGGAAC pLX_317 13.7% 65.1% 63.8% V5 (many diffs) n/a
Download CSV