Transcript: Human XM_017022182.1

PREDICTED: Homo sapiens leukocyte receptor tyrosine kinase (LTK), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LTK (4058)
Length:
2741
CDS:
179..2692

Additional Resources:

NCBI RefSeq record:
XM_017022182.1
NBCI Gene record:
LTK (4058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003157 CTTTGGGATGGCACGAGATAT pLKO.1 2089 CDS 100% 13.200 18.480 N LTK n/a
2 TRCN0000235410 TGTATGAGGGACTGGTAATTG pLKO_005 1668 CDS 100% 13.200 18.480 N LTK n/a
3 TRCN0000235412 TTTGGGATGGCACGAGATATC pLKO_005 2090 CDS 100% 10.800 15.120 N LTK n/a
4 TRCN0000197029 GATCTTTGGAGTGCCTAAGAC pLKO.1 2526 CDS 100% 4.950 6.930 N LTK n/a
5 TRCN0000003156 CGTCTTCGTCTCAGCAATCTT pLKO.1 601 CDS 100% 5.625 4.500 N LTK n/a
6 TRCN0000235411 CACTTCATCCACAGGGATATT pLKO_005 2009 CDS 100% 13.200 9.240 N LTK n/a
7 TRCN0000235414 AGTTTCGCCATCAGAACATTG pLKO_005 1797 CDS 100% 10.800 7.560 N LTK n/a
8 TRCN0000380588 TCTTCGTCTCAGCAATCTTCT pLKO_005 603 CDS 100% 4.950 3.465 N LTK n/a
9 TRCN0000003154 GCCAATGTTACTCTGCTCAGA pLKO.1 1619 CDS 100% 2.640 1.848 N LTK n/a
10 TRCN0000003155 GATCTTCTCACTGGGCTACAT pLKO.1 2242 CDS 100% 4.950 2.970 N LTK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488085 GATTCACTGCCTCCTGAAGAAAGG pLX_317 25.5% 48.1% .9% V5 (not translated due to prior stop codon) 1_1303del n/a
Download CSV