Transcript: Human XM_017022312.1

PREDICTED: Homo sapiens RAB8B, member RAS oncogene family (RAB8B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB8B (51762)
Length:
4932
CDS:
395..775

Additional Resources:

NCBI RefSeq record:
XM_017022312.1
NBCI Gene record:
RAB8B (51762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022312.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380248 GTCGTGAAGTTCTAGACAAAT pLKO_005 1131 3UTR 100% 13.200 18.480 N RAB8B n/a
2 TRCN0000047878 CCGATCAAAGAAGACCAGTTT pLKO.1 733 CDS 100% 4.950 6.930 N RAB8B n/a
3 TRCN0000379718 ACCTGTTGCAGAAGCGGTTAT pLKO_005 1030 3UTR 100% 10.800 8.640 N RAB8B n/a
4 TRCN0000047880 CGAAAGAATGATCCTGGGTAA pLKO.1 493 CDS 100% 4.050 3.240 N RAB8B n/a
5 TRCN0000047881 GCTAGCAATTGACTATGGGAT pLKO.1 565 CDS 100% 2.640 2.112 N RAB8B n/a
6 TRCN0000047879 CCTGGGTAACAAATGTGATAT pLKO.1 505 CDS 100% 13.200 9.240 N RAB8B n/a
7 TRCN0000382238 GAATGATCCTGGGTAACAAAT pLKO_005 498 CDS 100% 13.200 9.240 N RAB8B n/a
8 TRCN0000380132 TTACTGCCTTGGTAGCATTTA pLKO_005 1243 3UTR 100% 13.200 9.240 N RAB8B n/a
9 TRCN0000047882 GATAGAACTAGATGGAAAGAA pLKO.1 298 5UTR 100% 5.625 3.938 N RAB8B n/a
10 TRCN0000380390 AGAAGCTAGCAATTGACTATG pLKO_005 561 CDS 100% 10.800 6.480 N RAB8B n/a
11 TRCN0000100538 CAGGAAAGATTCCGAACAATT pLKO.1 350 5UTR 100% 13.200 7.920 N Rab8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022312.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03380 pDONR223 100% 60.8% 60.8% None 0_1ins243 n/a
2 ccsbBroad304_03380 pLX_304 0% 60.8% 60.8% V5 0_1ins243 n/a
3 TRCN0000478806 GCCCACGTACTTGGGCGTTCCTCG pLX_317 56.6% 60.8% 60.8% V5 0_1ins243 n/a
Download CSV