Transcript: Human XM_017022436.1

PREDICTED: Homo sapiens ATPase phospholipid transporting 10A (putative) (ATP10A), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP10A (57194)
Length:
4873
CDS:
184..4242

Additional Resources:

NCBI RefSeq record:
XM_017022436.1
NBCI Gene record:
ATP10A (57194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369467 CCACGAACGTTCTGGTTTAAC pLKO_005 3244 CDS 100% 13.200 18.480 N ATP10A n/a
2 TRCN0000364781 GACTGCGCACTGAGTACAAAT pLKO_005 4551 3UTR 100% 13.200 18.480 N ATP10A n/a
3 TRCN0000376425 GCGACTTTGCAGTGCCGAAAT pLKO_005 2921 CDS 100% 10.800 15.120 N ATP10A n/a
4 TRCN0000376424 GCGTCTTCGCTGCAACGAAAT pLKO_005 249 CDS 100% 10.800 15.120 N ATP10A n/a
5 TRCN0000051083 CGGCTGCATCATACATGACAA pLKO.1 474 CDS 100% 4.950 3.960 N ATP10A n/a
6 TRCN0000364780 ACGGAGTCCCTGAAACTATTT pLKO_005 2348 CDS 100% 13.200 9.240 N ATP10A n/a
7 TRCN0000364799 CCAGACCACAGACTACTTATA pLKO_005 4195 CDS 100% 13.200 9.240 N ATP10A n/a
8 TRCN0000051084 GCCAAGAGAGTTCTGAGTAAA pLKO.1 2182 CDS 100% 13.200 9.240 N ATP10A n/a
9 TRCN0000377328 GAATATTCTCATGATGCAAAT pLKO_005 1084 CDS 100% 10.800 7.560 N ATP10A n/a
10 TRCN0000051086 CCTTATACGTTTCCATTGAAA pLKO.1 869 CDS 100% 5.625 3.938 N ATP10A n/a
11 TRCN0000051085 CCAGTGGTATCTAATCTTCTT pLKO.1 3099 CDS 100% 4.950 3.465 N ATP10A n/a
12 TRCN0000051087 GACTACTTATAGGAGCATCTT pLKO.1 4205 CDS 100% 4.950 3.465 N ATP10A n/a
13 TRCN0000369468 GCAGTTGTATGACGAAGAAAC pLKO_005 930 CDS 100% 10.800 6.480 N ATP10A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.