Transcript: Human XM_017022446.2

PREDICTED: Homo sapiens immunoglobulin superfamily containing leucine rich repeat 2 (ISLR2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ISLR2 (57611)
Length:
2842
CDS:
339..1745

Additional Resources:

NCBI RefSeq record:
XM_017022446.2
NBCI Gene record:
ISLR2 (57611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146567 CACAACTTCATATCCAGCTTT pLKO.1 660 CDS 100% 4.950 6.930 N ISLR2 n/a
2 TRCN0000414653 CTTAGTCTGTCCGCGAACAAG pLKO_005 504 CDS 100% 4.950 6.930 N ISLR2 n/a
3 TRCN0000179714 GCAACTCTATCACAATCCCTT pLKO.1 866 CDS 100% 2.640 3.696 N ISLR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03836 pDONR223 100% 62.6% 62.5% None 1399_1401delCAT;1404_1405ins834 n/a
2 ccsbBroad304_03836 pLX_304 0% 62.6% 62.5% V5 1399_1401delCAT;1404_1405ins834 n/a
3 TRCN0000477821 GCCTGAATCCTAGTTCCCCTCACC pLX_317 15.3% 62.6% 62.5% V5 1399_1401delCAT;1404_1405ins834 n/a
Download CSV