Construct: ORF TRCN0000477821
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012730.1_s317c1
- Derived from:
- ccsbBroadEn_03836
- DNA Barcode:
- GCCTGAATCCTAGTTCCCCTCACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ISLR2 (57611)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477821
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | NM_001130136.1 | 100% | 100% | |
2 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | NM_001130137.1 | 100% | 100% | |
3 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | NM_001130138.1 | 100% | 100% | |
4 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | NM_020851.3 | 100% | 100% | |
5 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XM_011521840.3 | 100% | 100% | |
6 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XM_011521841.1 | 100% | 100% | |
7 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XM_024450003.1 | 100% | 100% | |
8 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XM_024450004.1 | 100% | 100% | |
9 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XM_024450005.1 | 100% | 100% | |
10 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XM_024450006.1 | 100% | 100% | |
11 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XM_024450007.1 | 100% | 100% | |
12 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XM_024450008.1 | 100% | 100% | |
13 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XR_931875.3 | 63.2% | (many diffs) | |
14 | human | 57611 | ISLR2 | immunoglobulin superfamily ... | XM_017022446.2 | 62.6% | 62.5% | 1399_1401delCAT;1404_1405ins834 |
15 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | NM_001161536.1 | 84.6% | 89.4% | (many diffs) |
16 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | NM_001161537.1 | 84.6% | 89.4% | (many diffs) |
17 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | NM_001161538.1 | 84.6% | 89.4% | (many diffs) |
18 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | NM_001161539.1 | 84.6% | 89.4% | (many diffs) |
19 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | NM_001161540.1 | 84.6% | 89.4% | (many diffs) |
20 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | NM_001161541.1 | 84.6% | 89.4% | (many diffs) |
21 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | NM_177193.5 | 84.6% | 89.4% | (many diffs) |
22 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | XM_006511229.3 | 84.6% | 89.4% | (many diffs) |
23 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | XM_006511230.2 | 84.6% | 89.4% | (many diffs) |
24 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | XM_006511231.3 | 84.6% | 89.4% | (many diffs) |
25 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | XM_006511232.3 | 84.6% | 89.4% | (many diffs) |
26 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | XM_006511233.2 | 84.6% | 89.4% | (many diffs) |
27 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | XM_006511234.3 | 84.6% | 89.4% | (many diffs) |
28 | mouse | 320563 | Islr2 | immunoglobulin superfamily ... | NM_001161535.1 | 79.9% | 84.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2304
- ORF length:
- 2235
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gttccccctt cgggccctgt ggttggtctg ggcgcttcta ggagtggccg 121 gatcatgccc ggagccgtgc gcctgcgtgg acaagtacgc tcaccagttc gcggactgcg 181 cttacaaaga gttgcgtgag gtgccggaag gactgcctgc caacgtgacg acgcttagtc 241 tgtccgcgaa caagatcact gtgctgcggc gcggggcctt cgccgacgtc acacaggtca 301 cgtcgctgtg gctggcgcac aatgaggtgc gcaccgtgga gccaggcgca ctggccgtgc 361 tgagtcagct caagaacctc gatctgagcc acaacttcat atccagcttt ccgtggagcg 421 acctgcgcaa cctgagcgcg ctgcagctgc tcaaaatgaa ccacaaccgc ctgggctctc 481 tgccccggga cgcactcggt gcgctacccg acctgcgttc cctgcgcatc aacaacaacc 541 ggctgcgtac gctggcgcct ggcaccttcg acgcgcttag cgcgctgtca cacttgcaac 601 tctatcacaa tcccttccac tgcggctgcg gccttgtgtg gctgcaggcc tgggccgcga 661 gcacccgggt gtccttaccc gagcccgact ccattgcttg tgcctcgcct cccgcgctgc 721 agggggtgcc ggtgtaccgc ctgcccgccc tgccctgtgc accgcccagc gtgcatctga 781 gtgccgagcc accgcttgaa gcacccggca ccccactgcg cgcaggactg gcgttcgtgt 841 tacactgcat cgccgacggc caccctacgc ctcgcctgca atggcaactt cagatccccg 901 gtggcaccgt agtcttagag ccaccggttc tgagcgggga ggacgacggg gttggggcgg 961 aggaaggaga gggagaagga gatggggatt tgctgacgca gacccaagcc caaacgccga 1021 ctccagcacc cgcttggccg gcgcccccag ccacaccgcg cttcctggcc ctcgcaaatg 1081 gctccctgtt ggtgcccctc ctgagtgcca aggaggcggg cgtctacact tgccgtgcac 1141 acaatgagct gggcgccaac tctacgtcaa tacgcgtggc ggtggcagca accgggcccc 1201 caaaacacgc gcctggcgcc gggggagaac ccgacggaca ggccccgacc tctgagcgca 1261 agtccacagc caagggccgg ggcaacagcg tcctgccttc caaacccgag ggcaaaatca 1321 aaggccaagg cctggccaag gtcagcattc tcggggagac cgagacggag ccggaggagg 1381 acacaagtga gggagaggag gccgaagacc agatcctcgc ggacccggcg gaggagcagc 1441 gctgtggcaa cggggacccc tctcggtacg tttctaacca cgcgttcaac cagagcgcag 1501 agctcaagcc gcacgtcttc gagctgggcg tcatcgcgct ggatgtggcg gagcgcgagg 1561 cgcgggtgca gctgactccg ctggctgcgc gctggggccc tgggcccggc ggggctggcg 1621 gagccccgcg acccgggcgg cgacccctgc gcctactcta tctgtgtcca gcggggggcg 1681 gcgcggcagt gcagtggtcc cgcgtagagg aaggcgtcaa cgcctactgg ttccgcggcc 1741 tgcggccggg taccaactac tccgtgtgcc tggcgctggc gggcgaagcc tgccacgtgc 1801 aagtggtgtt ttccaccaag aaggagctcc catcgctgct ggtcatagtg gcagtgagcg 1861 tattcctcct ggtgctggcc acagtgcccc ttctgggcgc cgcctgctgc catctgctgg 1921 ctaaacaccc gggcaagccc taccgtctga tcctgcggcc tcaggccCCT GACCCTATGG 1981 AGAAGCGCAT CGCCGCAGAC TTCGACCCGC GTGCTTCGTA CCTCGAGTCC GAGAAAAGCT 2041 ACCCGGCAGG CGGCGAGGCG GGCGGCGAGG AGCCAGAGGA CGTGCAGGGG GAGGGCCTTG 2101 ATGAAGACGC GGAGCAGGGA GACCCAAGTG GGGACCTGCA GAGAGAGGAG AGCCTGGCGG 2161 CCTGCTCACT GGTGGAGTCC CAGTCCAAGG CCAACCAAGA GGAGTTCGAG GCGGGCTCTG 2221 AGTACAGCGA TCGGCTGCCC CTGGGCGCCG AGGCGGTCAA CATCGCCCAG GAGATTAATG 2281 GCAACTACAG GCAGACGGCA GGCTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 2341 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 2401 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG CCTGAATCCT 2461 AGTTCCCCTC ACCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 2521 att