Transcript: Human XM_017022586.1

PREDICTED: Homo sapiens thrombospondin type 1 domain containing 4 (THSD4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THSD4 (79875)
Length:
9328
CDS:
1412..3415

Additional Resources:

NCBI RefSeq record:
XM_017022586.1
NBCI Gene record:
THSD4 (79875)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118214 CTGATGACATGACTCTAAGTA pLKO.1 3180 CDS 100% 5.625 7.875 N THSD4 n/a
2 TRCN0000118213 CCAAATGGTTTAGCACCGAAT pLKO.1 3099 CDS 100% 4.050 5.670 N THSD4 n/a
3 TRCN0000118212 CCCTGAAATCTTTCCGGTCAA pLKO.1 4267 3UTR 100% 4.050 2.835 N THSD4 n/a
4 TRCN0000118215 CTGTGTCTACAACTACTACAA pLKO.1 3328 CDS 100% 4.950 2.970 N THSD4 n/a
5 TRCN0000118216 CCTGAGATGTTCACCTCAGAA pLKO.1 2090 CDS 100% 0.495 0.297 N THSD4 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 14 5UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 14 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12639 pDONR223 100% 72.6% 72.2% None (many diffs) n/a
2 ccsbBroad304_12639 pLX_304 0% 72.6% 72.2% V5 (many diffs) n/a
3 TRCN0000465313 GCCTACCTGTGCTGAACTGAAAGG pLX_317 23.8% 72.6% 72.2% V5 (many diffs) n/a
Download CSV