Transcript: Human XM_017022673.2

PREDICTED: Homo sapiens multiple EGF like domains 11 (MEGF11), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEGF11 (84465)
Length:
3720
CDS:
564..3629

Additional Resources:

NCBI RefSeq record:
XM_017022673.2
NBCI Gene record:
MEGF11 (84465)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154867 GCTGAATCCCTACACCAAGAT pLKO.1 3056 CDS 100% 4.950 6.930 N MEGF11 n/a
2 TRCN0000152584 GTCCATCTGTAGCTGTAACAA pLKO.1 1904 CDS 100% 5.625 3.938 N MEGF11 n/a
3 TRCN0000119473 GCTATGTGAGTGCATGAACAA pLKO.1 2945 CDS 100% 4.950 3.465 N Megf11 n/a
4 TRCN0000119474 GAACACATACATTATGGACAA pLKO.1 3587 CDS 100% 4.050 2.835 N Megf11 n/a
5 TRCN0000156151 CTTTCCTGGATGGATTGGCAA pLKO.1 2615 CDS 100% 2.640 1.848 N MEGF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.