Transcript: Human XM_017022729.1

PREDICTED: Homo sapiens transglutaminase 5 (TGM5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TGM5 (9333)
Length:
1973
CDS:
244..1377

Additional Resources:

NCBI RefSeq record:
XM_017022729.1
NBCI Gene record:
TGM5 (9333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056251 CCAGTACCTGTCAACAGACAA pLKO.1 969 CDS 100% 4.950 3.960 N TGM5 n/a
2 TRCN0000426215 TATCCAAGCATCACGATTAAT pLKO_005 1069 CDS 100% 15.000 10.500 N TGM5 n/a
3 TRCN0000056248 CCACTCTCCATACAGGTGATA pLKO.1 1117 CDS 100% 4.950 3.465 N TGM5 n/a
4 TRCN0000056249 CTGAACTATGACACGCCCTTT pLKO.1 376 CDS 100% 4.050 2.835 N TGM5 n/a
5 TRCN0000413360 TATGCTAGGCACTCAACAAAT pLKO_005 1613 3UTR 100% 13.200 7.920 N TGM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02141 pDONR223 100% 52.3% 52.3% None 0_1ins1029 n/a
2 ccsbBroad304_02141 pLX_304 0% 52.3% 52.3% V5 0_1ins1029 n/a
3 TRCN0000477164 ACGAGTGTGTCCAGGAGGCTTATC pLX_317 16.2% 52.3% 52.3% V5 0_1ins1029 n/a
4 ccsbBroadEn_07392 pDONR223 100% 52.3% 52.3% None 0_1ins1029 n/a
5 ccsbBroad304_07392 pLX_304 0% 52.3% 52.3% V5 0_1ins1029 n/a
6 TRCN0000477414 GCTGTCCCCGGGACTGGGAACTTT pLX_317 19.9% 52.3% 52.3% V5 0_1ins1029 n/a
Download CSV