Transcript: Human XM_017023004.1

PREDICTED: Homo sapiens deoxyribonuclease 1 (DNASE1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNASE1 (1773)
Length:
4449
CDS:
1173..1736

Additional Resources:

NCBI RefSeq record:
XM_017023004.1
NBCI Gene record:
DNASE1 (1773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234776 AGCGCTACCTGTTCGTGTACA pLKO_005 1233 CDS 100% 4.950 6.930 N DNASE1 n/a
2 TRCN0000234779 GACTCGGCTCTTCCCTTTAAC pLKO_005 1569 CDS 100% 13.200 10.560 N DNASE1 n/a
3 TRCN0000049680 GCCTTCAACATCCAGACATTT pLKO.1 1102 5UTR 100% 13.200 9.240 N DNASE1 n/a
4 TRCN0000049681 CTCGGCTCTTCCCTTTAACTT pLKO.1 1571 CDS 100% 5.625 3.938 N DNASE1 n/a
5 TRCN0000234778 TCATGTTGATGGGCGACTTCA pLKO_005 1375 CDS 100% 4.950 3.465 N DNASE1 n/a
6 TRCN0000234777 TGCGGTGGACAGCTACTACTA pLKO_005 1270 CDS 100% 4.950 3.465 N DNASE1 n/a
7 TRCN0000234775 ACTGGGACGGAACAGCTATAA pLKO_005 1210 CDS 100% 13.200 7.920 N DNASE1 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2788 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2789 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.