Transcript: Human XM_017023020.2

PREDICTED: Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACSF3 (197322)
Length:
7647
CDS:
4672..6102

Additional Resources:

NCBI RefSeq record:
XM_017023020.2
NBCI Gene record:
ACSF3 (197322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155266 GATGGGCAAGATTGACAAGAA pLKO.1 1247 5UTR 100% 4.950 6.930 N ACSF3 n/a
2 TRCN0000231121 CTCAAAGAGTGGGCCAGAAAT pLKO_005 1164 5UTR 100% 13.200 17.160 N ACSF3 n/a
3 TRCN0000231120 ACCCTCCGTGTTTCGAGAATA pLKO_005 801 5UTR 100% 13.200 10.560 N ACSF3 n/a
4 TRCN0000218624 TTATGGCAGTGCCTACAATAT pLKO_005 532 5UTR 100% 13.200 10.560 N ACSF3 n/a
5 TRCN0000156690 GCACCCACGTTGCATTTACTT pLKO.1 2196 5UTR 100% 5.625 4.500 N ACSF3 n/a
6 TRCN0000156922 GCCTGAACTTACCCAGAACAT pLKO.1 2345 5UTR 100% 4.950 3.960 N ACSF3 n/a
7 TRCN0000231122 CAAATCAGGTCACGTAGAATC pLKO_005 1407 5UTR 100% 10.800 7.560 N ACSF3 n/a
8 TRCN0000155629 CCTGAACTTACCCAGAACATT pLKO.1 2346 5UTR 100% 5.625 3.938 N ACSF3 n/a
9 TRCN0000157714 CATCAAGACTGGAGGCTACAA pLKO.1 995 5UTR 100% 4.950 3.465 N ACSF3 n/a
10 TRCN0000156364 CAGGATTTCTTGCGTGCAGTT pLKO.1 603 5UTR 100% 4.050 2.835 N ACSF3 n/a
11 TRCN0000157272 GATGTGGCTGTGATTGGAGTT pLKO.1 1068 5UTR 100% 4.050 2.835 N ACSF3 n/a
12 TRCN0000156574 GTGGACATCATCAAGACTGGA pLKO.1 987 5UTR 100% 2.640 1.848 N ACSF3 n/a
13 TRCN0000150724 CCAGAAGTTTCTGGACAATTT pLKO.1 2257 5UTR 100% 1.320 0.924 N ACSF3 n/a
14 TRCN0000154382 CGGATCAATGTCTTTATGGCA pLKO.1 519 5UTR 100% 0.750 0.525 N ACSF3 n/a
15 TRCN0000156424 CATCATCAAGACTGGAGGCTA pLKO.1 992 5UTR 100% 2.640 1.584 N ACSF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.