Transcript: Human XM_017023036.2

PREDICTED: Homo sapiens NLR family CARD domain containing 3 (NLRC3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NLRC3 (197358)
Length:
6547
CDS:
538..3762

Additional Resources:

NCBI RefSeq record:
XM_017023036.2
NBCI Gene record:
NLRC3 (197358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358889 GCTCATGTTCTCCAGTAATAG pLKO_005 2910 CDS 100% 13.200 18.480 N NLRC3 n/a
2 TRCN0000168401 GCAACCTCTTTCCGGAAGTTT pLKO.1 1328 CDS 100% 5.625 7.875 N NLRC3 n/a
3 TRCN0000168587 GAGCTCATGTTCTCCAGTAAT pLKO.1 2908 CDS 100% 13.200 10.560 N NLRC3 n/a
4 TRCN0000168194 CGACTTAAGAGGAAATGCCAT pLKO.1 3501 CDS 100% 2.640 2.112 N NLRC3 n/a
5 TRCN0000358887 AGCTCTACTCATGGTACTTTA pLKO_005 1649 CDS 100% 13.200 9.240 N NLRC3 n/a
6 TRCN0000358888 CCTTGGAGATTCTCGACTTAA pLKO_005 3488 CDS 100% 13.200 9.240 N NLRC3 n/a
7 TRCN0000168383 GTGAACAGAACCTTGGAGATT pLKO.1 3478 CDS 100% 4.950 3.465 N NLRC3 n/a
8 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 4619 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5024 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 4823 3UTR 100% 4.950 2.475 Y CCNJL n/a
11 TRCN0000176177 GAGCAATTCCATCAGTGACAT pLKO.1 3006 CDS 100% 4.950 3.465 N Nlrc3 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5024 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.