Transcript: Human XM_017023259.2

PREDICTED: Homo sapiens poly(A)-specific ribonuclease (PARN), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARN (5073)
Length:
1959
CDS:
588..1508

Additional Resources:

NCBI RefSeq record:
XM_017023259.2
NBCI Gene record:
PARN (5073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049746 CCTATGTATCTCCTAACACTT pLKO.1 273 5UTR 100% 4.950 6.930 N PARN n/a
2 TRCN0000049745 GCCTTTGGTAACATTCAGATA pLKO.1 1149 CDS 100% 4.950 3.465 N PARN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01146 pDONR223 100% 45.7% 38.8% None (many diffs) n/a
2 ccsbBroad304_01146 pLX_304 0% 45.7% 38.8% V5 (many diffs) n/a
3 TRCN0000478950 AAAGAAAACACCACATCATTTCTC pLX_317 20.5% 45.7% 38.8% V5 (many diffs) n/a
Download CSV