Transcript: Human XM_017023286.2

PREDICTED: Homo sapiens beta-carotene oxygenase 1 (BCO1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCO1 (53630)
Length:
2463
CDS:
462..1898

Additional Resources:

NCBI RefSeq record:
XM_017023286.2
NBCI Gene record:
BCO1 (53630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416481 ATGGATCTCCATGGATTATTC pLKO_005 1785 CDS 100% 13.200 18.480 N BCO1 n/a
2 TRCN0000064727 CGTAAATACGTGGCGGTAAAT pLKO.1 942 CDS 100% 13.200 18.480 N BCO1 n/a
3 TRCN0000064726 CGATACCTACAACACCAATAT pLKO.1 689 CDS 100% 13.200 10.560 N BCO1 n/a
4 TRCN0000426026 AGCCTTTCAGGTTGGATATTC pLKO_005 1213 CDS 100% 13.200 9.240 N BCO1 n/a
5 TRCN0000432144 GAACGAGCCACTAACCTATTA pLKO_005 2221 3UTR 100% 13.200 9.240 N BCO1 n/a
6 TRCN0000064724 CCAAGCTACTACCACAGCTTT pLKO.1 1158 CDS 100% 0.495 0.347 N BCO1 n/a
7 TRCN0000434992 AGAGACGGTGAAGTCTATTAC pLKO_005 648 CDS 100% 13.200 7.920 N BCO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15860 pDONR223 0% 87.3% 87.3% None 1206_1207ins207 n/a
2 ccsbBroad304_15860 pLX_304 0% 87.3% 87.3% V5 1206_1207ins207 n/a
3 TRCN0000481081 GAGACCCAGAGGGCCAACGCAGAT pLX_317 28.8% 87.3% 87.3% V5 1206_1207ins207 n/a
4 ccsbBroadEn_08350 pDONR223 100% 87.2% 87.2% None 105T>C;801A>T;1206_1207ins207 n/a
5 ccsbBroad304_08350 pLX_304 0% 87.2% 87.2% V5 105T>C;801A>T;1206_1207ins207 n/a
6 TRCN0000481483 CATGCGCTACTTAATTGAAGTGCC pLX_317 29.7% 87.2% 87.2% V5 105T>C;801A>T;1206_1207ins207 n/a
Download CSV