Transcript: Human XM_017023289.1

PREDICTED: Homo sapiens beta-carotene oxygenase 1 (BCO1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCO1 (53630)
Length:
1541
CDS:
110..976

Additional Resources:

NCBI RefSeq record:
XM_017023289.1
NBCI Gene record:
BCO1 (53630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416481 ATGGATCTCCATGGATTATTC pLKO_005 863 CDS 100% 13.200 18.480 N BCO1 n/a
2 TRCN0000064725 CGGAGTAATCTTATCAGCCAT pLKO.1 745 CDS 100% 2.640 3.696 N BCO1 n/a
3 TRCN0000064723 CGGGTCAATTATGCTCACAAT pLKO.1 554 CDS 100% 4.950 3.960 N BCO1 n/a
4 TRCN0000426026 AGCCTTTCAGGTTGGATATTC pLKO_005 84 5UTR 100% 13.200 9.240 N BCO1 n/a
5 TRCN0000432144 GAACGAGCCACTAACCTATTA pLKO_005 1299 3UTR 100% 13.200 9.240 N BCO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15860 pDONR223 0% 52.6% 52.6% None 0_1ins777 n/a
2 ccsbBroad304_15860 pLX_304 0% 52.6% 52.6% V5 0_1ins777 n/a
3 TRCN0000481081 GAGACCCAGAGGGCCAACGCAGAT pLX_317 28.8% 52.6% 52.6% V5 0_1ins777 n/a
4 ccsbBroadEn_08350 pDONR223 100% 52.5% 52.4% None 0_1ins777;24A>T n/a
5 ccsbBroad304_08350 pLX_304 0% 52.5% 52.4% V5 0_1ins777;24A>T n/a
6 TRCN0000481483 CATGCGCTACTTAATTGAAGTGCC pLX_317 29.7% 52.5% 52.4% V5 0_1ins777;24A>T n/a
Download CSV