Transcript: Human XM_017023402.1

PREDICTED: Homo sapiens leucine rich repeat containing 36 (LRRC36), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC36 (55282)
Length:
1322
CDS:
20..1210

Additional Resources:

NCBI RefSeq record:
XM_017023402.1
NBCI Gene record:
LRRC36 (55282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416469 ATCTCCGATCCTTAGATTTAT pLKO_005 171 CDS 100% 15.000 21.000 N LRRC36 n/a
2 TRCN0000128589 GTATCTAATACAGAGCGTCTT pLKO.1 1162 CDS 100% 4.050 3.240 N LRRC36 n/a
3 TRCN0000413366 CTTTCATTGCAGGGATCTTAT pLKO_005 104 CDS 100% 13.200 9.240 N LRRC36 n/a
4 TRCN0000129364 GCAGCTGAATAAGGAGCCAAA pLKO.1 1024 CDS 100% 4.050 2.835 N LRRC36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08506 pDONR223 100% 52.4% 48.7% None 127G>A;576_577ins928;731_732ins146 n/a
2 ccsbBroad304_08506 pLX_304 0% 52.4% 48.7% V5 127G>A;576_577ins928;731_732ins146 n/a
3 TRCN0000477949 CACCACCCGTAGACATTTTCTGTA pLX_317 12.9% 52.4% 48.7% V5 127G>A;576_577ins928;731_732ins146 n/a
Download CSV