Transcript: Human XM_017023456.2

PREDICTED: Homo sapiens centromere protein N (CENPN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CENPN (55839)
Length:
842
CDS:
192..806

Additional Resources:

NCBI RefSeq record:
XM_017023456.2
NBCI Gene record:
CENPN (55839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000325 GATGAGTAAAGGACCAGGTGA pLKO.1 452 CDS 100% 2.640 2.112 N CENPN n/a
2 TRCN0000297272 GATGAGTAAAGGACCAGGTGA pLKO_005 452 CDS 100% 2.640 2.112 N CENPN n/a
3 TRCN0000279945 GCCCTGTTAGACATCATTTAT pLKO_005 390 CDS 100% 15.000 10.500 N CENPN n/a
4 TRCN0000000322 ATGAGTAAAGGACCAGGTGAA pLKO.1 453 CDS 100% 4.050 2.835 N CENPN n/a
5 TRCN0000000321 TGAACTGACAACAATCCTGAA pLKO.1 248 CDS 100% 4.050 2.835 N CENPN n/a
6 TRCN0000279878 TGAACTGACAACAATCCTGAA pLKO_005 248 CDS 100% 4.050 2.835 N CENPN n/a
7 TRCN0000000323 ACAGTACACAAAGCCAAACCA pLKO.1 608 CDS 100% 3.000 2.100 N CENPN n/a
8 TRCN0000279880 ACAGTACACAAAGCCAAACCA pLKO_005 608 CDS 100% 3.000 2.100 N CENPN n/a
9 TRCN0000000324 AGAGAAACTGAGGAGAATGCA pLKO.1 561 CDS 100% 3.000 2.100 N CENPN n/a
10 TRCN0000279942 AGAGAAACTGAGGAGAATGCA pLKO_005 561 CDS 100% 3.000 2.100 N CENPN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15915 pDONR223 0% 99.8% 99.5% None 252A>T n/a
2 ccsbBroad304_15915 pLX_304 0% 99.8% 99.5% V5 252A>T n/a
3 TRCN0000468938 AGGTTCCTGCTAGTATCATAGCCG pLX_317 72.9% 99.8% 99.5% V5 252A>T n/a
Download CSV