Transcript: Human XM_017023710.1

PREDICTED: Homo sapiens activating transcription factor 7 interacting protein 2 (ATF7IP2), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATF7IP2 (80063)
Length:
3319
CDS:
1047..1928

Additional Resources:

NCBI RefSeq record:
XM_017023710.1
NBCI Gene record:
ATF7IP2 (80063)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433304 ATGGACCATTCTGTGATATAA pLKO_005 1873 CDS 100% 15.000 12.000 N ATF7IP2 n/a
2 TRCN0000430583 AGTGTAGTAGAACCAGTATTT pLKO_005 519 5UTR 100% 13.200 10.560 N ATF7IP2 n/a
3 TRCN0000414783 TTCTGTGGAAAGTCCTAATTT pLKO_005 1256 CDS 100% 15.000 10.500 N ATF7IP2 n/a
4 TRCN0000424982 TGATTCAGCAGGAGATCTATA pLKO_005 732 5UTR 100% 13.200 9.240 N ATF7IP2 n/a
5 TRCN0000016037 CCAATTCAGAATCACATGATA pLKO.1 375 5UTR 100% 5.625 3.938 N ATF7IP2 n/a
6 TRCN0000016033 GCCTGTACTTTATCTCAGTTT pLKO.1 1797 CDS 100% 4.950 3.465 N ATF7IP2 n/a
7 TRCN0000016035 CCCAGTGTATTGAGTGGTGTT pLKO.1 272 5UTR 100% 4.050 2.835 N ATF7IP2 n/a
8 TRCN0000016036 GCTGCTTCAAACTCAAAGGAA pLKO.1 1464 CDS 100% 3.000 2.100 N ATF7IP2 n/a
9 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 856 5UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12668 pDONR223 100% 42.9% 43% None 0_1ins1164;600C>A n/a
2 ccsbBroad304_12668 pLX_304 0% 42.9% 43% V5 0_1ins1164;600C>A n/a
3 TRCN0000491708 ATCAATATATCCTCCCGATGCGAG pLX_317 17.7% 42.9% 43% V5 0_1ins1164;600C>A n/a
Download CSV