Transcript: Human XM_017023764.1

PREDICTED: Homo sapiens family with sequence similarity 234 member A (FAM234A), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM234A (83986)
Length:
2955
CDS:
226..1857

Additional Resources:

NCBI RefSeq record:
XM_017023764.1
NBCI Gene record:
FAM234A (83986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163460 GTTCGTCGTCTCATTCGTCAT pLKO.1 414 CDS 100% 4.050 5.670 N FAM234A n/a
2 TRCN0000159494 CAGTTCTTTCATTGCAGTCAA pLKO.1 744 CDS 100% 4.950 3.960 N FAM234A n/a
3 TRCN0000163738 GCGAATGTGGAGGATAGACTA pLKO.1 462 CDS 100% 4.950 3.960 N FAM234A n/a
4 TRCN0000412603 TTCTGGCTGTGGATGATATAA pLKO_005 506 CDS 100% 15.000 10.500 N FAM234A n/a
5 TRCN0000436816 ACTGGGAGAGCATGCTCAATG pLKO_005 1121 CDS 100% 10.800 7.560 N FAM234A n/a
6 TRCN0000423748 CCTTGGCTGTAGCCGTTGAAA pLKO_005 1343 CDS 100% 5.625 3.938 N FAM234A n/a
7 TRCN0000164619 CAGATCCTGTTTCTGGACCTT pLKO.1 1384 CDS 100% 2.640 1.848 N FAM234A n/a
8 TRCN0000162308 CCAGTTCTTTCATTGCAGTCA pLKO.1 743 CDS 100% 2.640 1.848 N FAM234A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09141 pDONR223 100% 98.3% 98.1% None 383_384ins27;1622G>C n/a
2 ccsbBroad304_09141 pLX_304 0% 98.3% 98.1% V5 383_384ins27;1622G>C n/a
3 TRCN0000476580 ACACAAATACAAGTTTCCTGCATG pLX_317 12.2% 98.3% 98.1% V5 383_384ins27;1622G>C n/a
Download CSV