Transcript: Human XM_017024006.1

PREDICTED: Homo sapiens schlafen family member 12 like (SLFN12L), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLFN12L (100506736)
Length:
4938
CDS:
3169..4935

Additional Resources:

NCBI RefSeq record:
XM_017024006.1
NBCI Gene record:
SLFN12L (100506736)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337109 CTATGCTGAGCTGGTTCTAAA pLKO_005 3252 CDS 100% 13.200 10.560 N SLFN12L n/a
2 TRCN0000337110 GAGTTATCCTCTTCGTGAATA pLKO_005 4311 CDS 100% 13.200 10.560 N SLFN12L n/a
3 TRCN0000337184 ACTGGAGGGAGAGCATATTTA pLKO_005 3676 CDS 100% 15.000 10.500 N SLFN12L n/a
4 TRCN0000337111 CAGAACAGAACTTGGTTATAA pLKO_005 3780 CDS 100% 15.000 10.500 N SLFN12L n/a
5 TRCN0000337182 AGAGTTATCTTACTAAGTTAG pLKO_005 3983 CDS 100% 10.800 7.560 N SLFN12L n/a
6 TRCN0000151721 CGCAAGTAATTTACCCTGAAT pLKO.1 4766 CDS 100% 4.950 2.475 Y SLFN12 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2939 5UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2939 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08470 pDONR223 100% 80.2% 71% None (many diffs) n/a
2 ccsbBroad304_08470 pLX_304 0% 80.2% 71% V5 (many diffs) n/a
3 TRCN0000476272 TTCTATGGGACTCGTTTACGGAAC pLX_317 18.1% 80.2% 71% V5 (many diffs) n/a
Download CSV