Transcript: Human XM_017024011.1

PREDICTED: Homo sapiens ATP binding cassette subfamily A member 9 (ABCA9), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCA9 (10350)
Length:
6266
CDS:
85..4983

Additional Resources:

NCBI RefSeq record:
XM_017024011.1
NBCI Gene record:
ABCA9 (10350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433613 GGCGACAGAACATAGCTATAG pLKO_005 2909 CDS 100% 10.800 15.120 N ABCA9 n/a
2 TRCN0000059580 GCTCACTGTCAAGCAGTGAAT pLKO.1 577 CDS 100% 0.495 0.693 N ABCA9 n/a
3 TRCN0000059578 CCCATCTTACAATGGTGCTAT pLKO.1 2967 CDS 100% 4.950 3.960 N ABCA9 n/a
4 TRCN0000059581 CCGAATATGGAATCTCCTGAA pLKO.1 2070 CDS 100% 4.050 3.240 N ABCA9 n/a
5 TRCN0000059582 CCTCCTGCTAATGCAAATAAT pLKO.1 3351 CDS 100% 15.000 10.500 N ABCA9 n/a
6 TRCN0000427777 GATAGTTGCTACTGATCTAAA pLKO_005 3558 CDS 100% 13.200 9.240 N ABCA9 n/a
7 TRCN0000059579 CGGAAGGAATATGCAGGCAAA pLKO.1 3973 CDS 100% 4.050 2.835 N ABCA9 n/a
8 TRCN0000156019 CATGGAATACTATGCAGCCAT pLKO.1 5683 3UTR 100% 2.640 1.320 Y LOC340211 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11487 pDONR223 100% 9.9% 9.9% None 1_339del;826_4896del n/a
2 ccsbBroad304_11487 pLX_304 0% 9.9% 9.9% V5 1_339del;826_4896del n/a
3 TRCN0000471124 CAGGATAGTACGGTATTCATTTTC pLX_317 74.3% 9.9% 9.9% V5 1_339del;826_4896del n/a
Download CSV