Transcript: Human XM_017024028.2

PREDICTED: Homo sapiens retinoic acid induced 1 (RAI1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAI1 (10743)
Length:
6084
CDS:
155..6058

Additional Resources:

NCBI RefSeq record:
XM_017024028.2
NBCI Gene record:
RAI1 (10743)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014664 CCTCAAGAAGTTCGCATGTAA pLKO.1 4174 CDS 100% 5.625 4.500 N RAI1 n/a
2 TRCN0000274285 CCTCAAGAAGTTCGCATGTAA pLKO_005 4174 CDS 100% 5.625 4.500 N RAI1 n/a
3 TRCN0000274284 CTGCTCGCCAAGGACTATTAT pLKO_005 287 CDS 100% 15.000 10.500 N RAI1 n/a
4 TRCN0000380520 TCCAACCAACAGATCCTTAAA pLKO_005 4360 CDS 100% 13.200 9.240 N RAI1 n/a
5 TRCN0000014666 GCAGAAATCCAACCAACAGAT pLKO.1 4353 CDS 100% 4.950 3.465 N RAI1 n/a
6 TRCN0000014667 CCGCTTGAGAGAACACTCAAA pLKO.1 5357 CDS 100% 0.495 0.347 N RAI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14054 pDONR223 100% 48.1% 47.7% None (many diffs) n/a
2 ccsbBroad304_14054 pLX_304 0% 48.1% 47.7% V5 (many diffs) n/a
3 TRCN0000492271 GACGCAACCAAAGTCATCCTTGGT pLX_317 14.4% 48.1% 47.7% V5 (many diffs) n/a
Download CSV