Transcript: Human XM_017024034.2

PREDICTED: Homo sapiens CD300c molecule (CD300C), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD300C (10871)
Length:
1054
CDS:
326..1030

Additional Resources:

NCBI RefSeq record:
XM_017024034.2
NBCI Gene record:
CD300C (10871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062979 CGAGACTTTCATGATCCCATT pLKO.1 677 CDS 100% 4.050 2.430 N CD300C n/a
2 TRCN0000062981 GACAAGATTGTGGAGACCAAA pLKO.1 521 CDS 100% 4.950 2.475 Y CD300C n/a
3 TRCN0000163279 GAGAATCTCACAGAGGAGGAT pLKO.1 617 CDS 100% 2.640 1.320 Y CD300A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02542 pDONR223 100% 72.9% 55.9% None (many diffs) n/a
2 ccsbBroad304_02542 pLX_304 0% 72.9% 55.9% V5 (many diffs) n/a
3 TRCN0000472592 TTGACTTTGATGTATCAGATCTAC pLX_317 44.9% 72.9% 55.9% V5 (many diffs) n/a
Download CSV