Transcript: Human XM_017024040.2

PREDICTED: Homo sapiens RUN domain containing 3A (RUNDC3A), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RUNDC3A (10900)
Length:
2566
CDS:
195..1400

Additional Resources:

NCBI RefSeq record:
XM_017024040.2
NBCI Gene record:
RUNDC3A (10900)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072904 CCTAAAGTTCACGCAGAGCTA pLKO.1 794 CDS 100% 2.640 2.112 N RUNDC3A n/a
2 TRCN0000072903 GTTCTCCCTATGCCTGAATAT pLKO.1 1490 3UTR 100% 13.200 9.240 N RUNDC3A n/a
3 TRCN0000072907 GAAGCGCATGTCAGAATACAT pLKO.1 587 CDS 100% 5.625 3.938 N RUNDC3A n/a
4 TRCN0000072905 CATCGAGAACATGGAGAACAT pLKO.1 515 CDS 100% 4.950 3.465 N RUNDC3A n/a
5 TRCN0000072906 TGTGAGCAGCATCGAGAACAT pLKO.1 506 CDS 100% 4.950 3.465 N RUNDC3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07701 pDONR223 100% 98.9% 99% None 221_222insAGCCTGTGCCCC;717T>C n/a
2 ccsbBroad304_07701 pLX_304 0% 98.9% 99% V5 221_222insAGCCTGTGCCCC;717T>C n/a
3 TRCN0000467002 GGTTATATTCTAATGCGACATACC pLX_317 35.8% 98.9% 99% V5 221_222insAGCCTGTGCCCC;717T>C n/a
Download CSV