Transcript: Human XM_017024165.2

PREDICTED: Homo sapiens KRAB-A domain containing 2 (KRBA2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRBA2 (124751)
Length:
2974
CDS:
609..1841

Additional Resources:

NCBI RefSeq record:
XM_017024165.2
NBCI Gene record:
KRBA2 (124751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160401 CGTGATCGAATACGGTATTAT pLKO.1 903 CDS 100% 15.000 12.000 N KRBA2 n/a
2 TRCN0000159907 GAGGCAATGTTTGGCTATAAA pLKO.1 1587 CDS 100% 15.000 10.500 N KRBA2 n/a
3 TRCN0000428972 TCAGTGTCTTGTTAGATATTT pLKO_005 1279 CDS 100% 15.000 10.500 N KRBA2 n/a
4 TRCN0000412783 GAAGAAGTCATCACGTGATTA pLKO_005 809 CDS 100% 13.200 9.240 N KRBA2 n/a
5 TRCN0000160651 CAAATGCAAGTGAAATGGAAA pLKO.1 649 CDS 100% 4.950 3.465 N KRBA2 n/a
6 TRCN0000159586 CGAATACGGTATTATGTACAT pLKO.1 909 CDS 100% 4.950 3.465 N KRBA2 n/a
7 TRCN0000163273 GATGGTGAGGAATCAGGCTTT pLKO.1 1538 CDS 100% 4.050 2.835 N KRBA2 n/a
8 TRCN0000160316 CCAAGTTGAAATACTTGACAT pLKO.1 1151 CDS 100% 0.495 0.347 N KRBA2 n/a
9 TRCN0000160515 CAGGTCTGTGTATTTATTCTT pLKO.1 1990 3UTR 100% 5.625 3.375 N KRBA2 n/a
10 TRCN0000160176 CATAGTCATCTGAGAACTGTT pLKO.1 1884 3UTR 100% 4.950 2.970 N KRBA2 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2949 3UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 2126 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
13 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2949 3UTR 100% 10.800 5.400 Y CD3EAP n/a
14 TRCN0000162166 CAACATGATGAAACCCTGTAT pLKO.1 2133 3UTR 100% 4.950 2.475 Y SWSAP1 n/a
15 TRCN0000164260 CCAACATGATGAAACCCTGTA pLKO.1 2132 3UTR 100% 4.050 2.025 Y SWSAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.