Transcript: Human XM_017024183.2

PREDICTED: Homo sapiens cytochrome b5 domain containing 2 (CYB5D2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYB5D2 (124936)
Length:
1300
CDS:
390..815

Additional Resources:

NCBI RefSeq record:
XM_017024183.2
NBCI Gene record:
CYB5D2 (124936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024183.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152178 CACTTCACAATTGGCTTTCAT pLKO.1 733 CDS 100% 5.625 3.938 N CYB5D2 n/a
2 TRCN0000153552 CTGACACTTCACAATTGGCTT pLKO.1 729 CDS 100% 2.640 1.848 N CYB5D2 n/a
3 TRCN0000153364 GAGATGCTGACACTTCACAAT pLKO.1 723 CDS 100% 4.950 2.970 N CYB5D2 n/a
4 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 64 5UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024183.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04793 pDONR223 100% 51.1% 50% None (many diffs) n/a
2 ccsbBroad304_04793 pLX_304 0% 51.1% 50% V5 (many diffs) n/a
3 TRCN0000465792 GTGGAGCCAGTCCTACCCGTGGCC pLX_317 48.2% 51.1% 50% V5 (many diffs) n/a
Download CSV