Transcript: Human XM_017024345.2

PREDICTED: Homo sapiens sphingolipid transporter 3 (putative) (SPNS3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPNS3 (201305)
Length:
1333
CDS:
211..1023

Additional Resources:

NCBI RefSeq record:
XM_017024345.2
NBCI Gene record:
SPNS3 (201305)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153792 CACAGGACTTATCTCTAGTGT pLKO.1 753 CDS 100% 3.000 4.200 N SPNS3 n/a
2 TRCN0000153735 CCTATCTCACAGGACTTATCT pLKO.1 746 CDS 100% 5.625 3.938 N SPNS3 n/a
3 TRCN0000152513 GAGGAGGTACAAGAAAGTCAT pLKO.1 474 CDS 100% 4.950 3.465 N SPNS3 n/a
4 TRCN0000158382 CGAGGAGGTACAAGAAAGTCA pLKO.1 473 CDS 100% 3.000 1.800 N SPNS3 n/a
5 TRCN0000157784 CAGCAATGATGTGGACAGCAA pLKO.1 945 CDS 100% 2.640 1.584 N SPNS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13390 pDONR223 100% 68.2% 64.3% None (many diffs) n/a
2 ccsbBroad304_13390 pLX_304 0% 68.2% 64.3% V5 (many diffs) n/a
3 TRCN0000470856 TGTATGATCACCTAGATTGAGATT pLX_317 19.4% 68.2% 64.3% V5 (many diffs) n/a
Download CSV