Transcript: Human XM_017024359.1

PREDICTED: Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1E (PPM1E), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPM1E (22843)
Length:
7500
CDS:
1364..2914

Additional Resources:

NCBI RefSeq record:
XM_017024359.1
NBCI Gene record:
PPM1E (22843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024359.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001910 GTCTCATTTACGCCACCACTA pLKO.1 2647 CDS 100% 4.050 5.670 N PPM1E n/a
2 TRCN0000001908 CCCTCTAACTAATGGTATCTA pLKO.1 5421 3UTR 100% 5.625 4.500 N PPM1E n/a
3 TRCN0000273253 CCCTCTAACTAATGGTATCTA pLKO_005 5421 3UTR 100% 5.625 4.500 N PPM1E n/a
4 TRCN0000273254 GATCTTCCTTGGAGCTATAAA pLKO_005 2885 CDS 100% 15.000 10.500 N PPM1E n/a
5 TRCN0000379844 GCTGAACATAAGCCATATATC pLKO_005 1862 CDS 100% 13.200 9.240 N PPM1E n/a
6 TRCN0000273255 TCAGCAAACTACACGAGATTT pLKO_005 1263 5UTR 100% 13.200 9.240 N PPM1E n/a
7 TRCN0000001907 CCCAGCTTTATTATGAGACAT pLKO.1 1323 5UTR 100% 4.950 3.465 N PPM1E n/a
8 TRCN0000001909 CCCAGGTTATGCTTGTGAGAA pLKO.1 1695 CDS 100% 4.950 3.465 N PPM1E n/a
9 TRCN0000001906 GTGGAGATTGAGACAGTGAAA pLKO.1 1226 5UTR 100% 4.950 3.465 N PPM1E n/a
10 TRCN0000284945 GTGGAGATTGAGACAGTGAAA pLKO_005 1226 5UTR 100% 4.950 3.465 N PPM1E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024359.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11633 pDONR223 100% 68.1% 68.1% None 0_1ins723 n/a
2 TRCN0000475566 CTAACCTAATGTCGGTTCTATATT pLX_317 13.1% 68.1% 68.1% V5 0_1ins723 n/a
Download CSV