Transcript: Human XM_017024410.1

PREDICTED: Homo sapiens syntaxin binding protein 4 (STXBP4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STXBP4 (252983)
Length:
6334
CDS:
245..1960

Additional Resources:

NCBI RefSeq record:
XM_017024410.1
NBCI Gene record:
STXBP4 (252983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117834 CCTTACTTGATATGGATTGTT pLKO.1 1770 CDS 100% 5.625 7.875 N STXBP4 n/a
2 TRCN0000117832 CCGCCCTGTTTCTGTCAAATA pLKO.1 3700 3UTR 100% 13.200 10.560 N STXBP4 n/a
3 TRCN0000380252 ATGTTGGTGCACATGAAATTT pLKO_005 1113 CDS 100% 15.000 10.500 N STXBP4 n/a
4 TRCN0000381879 ATGGTACTCGACTGCCAATTA pLKO_005 1517 CDS 100% 13.200 9.240 N STXBP4 n/a
5 TRCN0000428653 TACTGTGGGTTTGTCTAATAC pLKO_005 850 CDS 100% 13.200 9.240 N STXBP4 n/a
6 TRCN0000379462 TGAATCTAAGGAACTTGTTAA pLKO_005 1738 CDS 100% 13.200 9.240 N STXBP4 n/a
7 TRCN0000380749 GATGTGAGCAGAGACGCATAA pLKO_005 1993 3UTR 100% 10.800 7.560 N STXBP4 n/a
8 TRCN0000380421 TAAATCCCTCTGTTCGCTTTA pLKO_005 924 CDS 100% 10.800 7.560 N STXBP4 n/a
9 TRCN0000117835 GCTTGGGAGATAGCATTCATA pLKO.1 548 CDS 100% 5.625 3.938 N STXBP4 n/a
10 TRCN0000117833 CCGACAACATTCAGCCAGAAA pLKO.1 579 CDS 100% 4.950 3.465 N STXBP4 n/a
11 TRCN0000379647 GGACCTCAAGCCTCAACATTA pLKO_005 641 CDS 100% 13.200 7.920 N STXBP4 n/a
12 TRCN0000117836 GTGTATCATTTGAAGAAGCAA pLKO.1 483 CDS 100% 3.000 1.800 N STXBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13447 pDONR223 100% 92.8% 92.6% None (many diffs) n/a
2 ccsbBroad304_13447 pLX_304 0% 92.8% 92.6% V5 (many diffs) n/a
3 TRCN0000475020 GGAGTATTTGACGGATTCCCAAGG pLX_317 37.5% 92.8% 92.6% V5 (many diffs) n/a
Download CSV