Transcript: Human XM_017024463.2

PREDICTED: Homo sapiens coiled-coil domain containing 57 (CCDC57), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC57 (284001)
Length:
3736
CDS:
265..3399

Additional Resources:

NCBI RefSeq record:
XM_017024463.2
NBCI Gene record:
CCDC57 (284001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139389 CACACGGTGACCTGTAAATCA pLKO.1 2962 CDS 100% 5.625 7.875 N CCDC57 n/a
2 TRCN0000167936 CGGGAGCTTAAGGTTAAACTA pLKO.1 871 CDS 100% 5.625 7.875 N CCDC57 n/a
3 TRCN0000173053 CCAGCAGGACATTGAAAGGTA pLKO.1 1458 CDS 100% 3.000 4.200 N CCDC57 n/a
4 TRCN0000166945 GAAGATGTGTTGGATCCTTTA pLKO.1 2065 CDS 100% 10.800 7.560 N CCDC57 n/a
5 TRCN0000167622 GATGCTCAAATTGCTCAACTA pLKO.1 1354 CDS 100% 4.950 3.465 N CCDC57 n/a
6 TRCN0000168788 GCAGGACATTGAAAGGTACAA pLKO.1 1461 CDS 100% 4.950 3.465 N CCDC57 n/a
7 TRCN0000167776 GAAACATTTAAGAGGAAGCAT pLKO.1 1099 CDS 100% 3.000 2.100 N CCDC57 n/a
8 TRCN0000139102 CCTTCACCCAAACATGAACCA pLKO.1 3294 CDS 100% 2.640 1.848 N CCDC57 n/a
9 TRCN0000140537 GAAGACACAACACAGCATCCA pLKO.1 2943 CDS 100% 2.640 1.848 N CCDC57 n/a
10 TRCN0000106345 GCAGCTAACCAGGAAGAAGTT pLKO.1 1074 CDS 100% 4.950 3.465 N Spata2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467565 ATATAGGGTACATATAATACCTAC pLX_317 5.4% 71.6% 71.4% V5 (many diffs) n/a
2 ccsbBroadEn_14460 pDONR223 100% 71.4% 71.4% None (many diffs) n/a
3 ccsbBroad304_14460 pLX_304 0% 71.4% 71.4% V5 (many diffs) n/a
Download CSV