Transcript: Human XM_017024493.2

PREDICTED: Homo sapiens tubulin tyrosine ligase like 6 (TTLL6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTLL6 (284076)
Length:
3656
CDS:
700..2916

Additional Resources:

NCBI RefSeq record:
XM_017024493.2
NBCI Gene record:
TTLL6 (284076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128712 CAAACAGTACATCCAGCCATT pLKO.1 1995 CDS 100% 4.050 3.240 N TTLL6 n/a
2 TRCN0000434273 GTGGAGGGTTCCGACTGATTT pLKO_005 1709 CDS 100% 13.200 9.240 N TTLL6 n/a
3 TRCN0000434328 CGGACAGGGTGGTATCCTTTA pLKO_005 2393 CDS 100% 10.800 7.560 N TTLL6 n/a
4 TRCN0000127680 CAACCTGGAAAGCTGTGACAA pLKO.1 1551 CDS 100% 4.950 3.465 N TTLL6 n/a
5 TRCN0000128251 GTCTTCCATTAGTTCCTAGTA pLKO.1 3047 3UTR 100% 4.950 3.465 N TTLL6 n/a
6 TRCN0000127969 GCTGCAACTTCACAAGGTCAA pLKO.1 3415 3UTR 100% 4.050 2.835 N TTLL6 n/a
7 TRCN0000130066 GCCATTGACATTAGTATCCTA pLKO.1 2010 CDS 100% 3.000 2.100 N TTLL6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13516 pDONR223 100% 76% 75.3% None (many diffs) n/a
2 ccsbBroad304_13516 pLX_304 0% 76% 75.3% V5 (many diffs) n/a
3 TRCN0000480069 GACCGGGGGAAGAGGGCGTTAACA pLX_317 18.7% 76% 75.3% V5 (many diffs) n/a
Download CSV