Transcript: Human XM_017024654.2

PREDICTED: Homo sapiens MAX network transcriptional repressor (MNT), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MNT (4335)
Length:
7273
CDS:
3540..4445

Additional Resources:

NCBI RefSeq record:
XM_017024654.2
NBCI Gene record:
MNT (4335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234789 TTACCGTAGATACTACTTAAA pLKO_005 5071 3UTR 100% 13.200 18.480 N MNT n/a
2 TRCN0000234788 GGACAACATAGACGAGGATAT pLKO_005 3704 CDS 100% 10.800 15.120 N MNT n/a
3 TRCN0000020397 CCCGGCTACTGTCATGGCAAA pLKO.1 4307 CDS 100% 1.350 1.890 N MNT n/a
4 TRCN0000085733 CCGAATGACTATGTCCAGATT pLKO.1 6518 3UTR 100% 4.950 3.465 N Mnt n/a
5 TRCN0000020398 GAGGACAACATAGACGAGGAT pLKO.1 3702 CDS 100% 2.640 1.848 N MNT n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1069 5UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000020394 CCTGCAAATCTAGTGCCGAAA pLKO.1 6503 3UTR 100% 4.050 5.670 N MNT n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1070 5UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6720 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2949 5UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.