Transcript: Human XM_017024665.1

PREDICTED: Homo sapiens tripartite motif containing 37 (TRIM37), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM37 (4591)
Length:
4307
CDS:
277..3144

Additional Resources:

NCBI RefSeq record:
XM_017024665.1
NBCI Gene record:
TRIM37 (4591)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024665.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376632 TTGTGCGAGGTTACTACTTAT pLKO_005 1130 CDS 100% 13.200 18.480 N TRIM37 n/a
2 TRCN0000221061 CCGTTTGGACTTACTCGCAAA pLKO.1 1311 CDS 100% 4.050 5.670 N TRIM37 n/a
3 TRCN0000221060 GCTAATGCTAAAGGAGGTCAT pLKO.1 2752 CDS 100% 4.050 5.670 N TRIM37 n/a
4 TRCN0000221062 CCACAGCATCATATTCTCGAA pLKO.1 2117 CDS 100% 2.640 3.696 N TRIM37 n/a
5 TRCN0000040786 GCTGGACTTGTAAGAAGTGTA pLKO.1 491 CDS 100% 4.950 3.960 N Trim37 n/a
6 TRCN0000316541 GCTGGACTTGTAAGAAGTGTA pLKO_005 491 CDS 100% 4.950 3.960 N Trim37 n/a
7 TRCN0000365347 ACTAGACATTGATCCATTAAT pLKO_005 2007 CDS 100% 15.000 10.500 N TRIM37 n/a
8 TRCN0000365348 ACATGGCAGTATCGGTGATAT pLKO_005 2616 CDS 100% 13.200 9.240 N TRIM37 n/a
9 TRCN0000370522 AGGACTTTGCTGGAGGTTAAA pLKO_005 1086 CDS 100% 13.200 9.240 N TRIM37 n/a
10 TRCN0000370523 TATGAGCAACACGTCACTAAA pLKO_005 580 CDS 100% 13.200 9.240 N TRIM37 n/a
11 TRCN0000221058 CCACCAGACTTTACCAGTGAA pLKO.1 967 CDS 100% 4.950 3.465 N TRIM37 n/a
12 TRCN0000221059 CCAGTGTAGCAGGTAGTCTAT pLKO.1 2471 CDS 100% 4.950 3.465 N TRIM37 n/a
13 TRCN0000040783 GCTTAGTTCAAGAAGTGGAAA pLKO.1 650 CDS 100% 4.950 3.465 N Trim37 n/a
14 TRCN0000349177 GCTTAGTTCAAGAAGTGGAAA pLKO_005 650 CDS 100% 4.950 3.465 N Trim37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024665.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06605 pDONR223 100% 93.9% 93.9% None (many diffs) n/a
2 ccsbBroad304_06605 pLX_304 0% 93.9% 93.9% V5 (many diffs) n/a
3 TRCN0000473990 TAGAACAAAGCACACACGATGAAC pLX_317 8.9% 93.9% 93.9% V5 (many diffs) n/a
Download CSV