Transcript: Human XM_017024738.1

PREDICTED: Homo sapiens platelet and endothelial cell adhesion molecule 1 (PECAM1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PECAM1 (5175)
Length:
3652
CDS:
123..2339

Additional Resources:

NCBI RefSeq record:
XM_017024738.1
NBCI Gene record:
PECAM1 (5175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373143 GTCGGACAGTGGGACGTATAT pLKO_005 1256 CDS 100% 13.200 18.480 N PECAM1 n/a
2 TRCN0000057798 CCATGCAATGAAACCAATAAA pLKO.1 2135 CDS 100% 15.000 10.500 N PECAM1 n/a
3 TRCN0000373187 CTATGACTCAGGGACATATAA pLKO_005 425 CDS 100% 15.000 10.500 N PECAM1 n/a
4 TRCN0000057801 CGGAGTGATCATTGCTCTCTT pLKO.1 1949 CDS 100% 4.950 3.465 N PECAM1 n/a
5 TRCN0000057799 GAGAGGACATTGTGCTGCAAT pLKO.1 1669 CDS 100% 4.950 3.465 N PECAM1 n/a
6 TRCN0000057802 GTGGTCAACATAACAGAACTA pLKO.1 1074 CDS 100% 4.950 3.465 N PECAM1 n/a
7 TRCN0000057800 GCTCCACATTAAGTGCACCAT pLKO.1 875 CDS 100% 2.640 1.848 N PECAM1 n/a
8 TRCN0000373188 CAGTGGAACTTTGCCTATTTC pLKO_005 1424 CDS 100% 13.200 7.920 N PECAM1 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3169 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3168 3UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.