Transcript: Human XM_017024810.2

PREDICTED: Homo sapiens schlafen family member 12 (SLFN12), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLFN12 (55106)
Length:
4889
CDS:
859..2595

Additional Resources:

NCBI RefSeq record:
XM_017024810.2
NBCI Gene record:
SLFN12 (55106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152338 CGGTATAGATTGCTTTCAGAA pLKO.1 2532 CDS 100% 4.950 6.930 N SLFN12 n/a
2 TRCN0000152802 GCATGTGAAAGATAACCGTGT pLKO.1 1824 CDS 100% 2.160 3.024 N SLFN12 n/a
3 TRCN0000152141 CAGAACTTGATCGGAAAGAAA pLKO.1 1421 CDS 100% 5.625 3.938 N SLFN12 n/a
4 TRCN0000150896 GTACTTAGACTTCATGCAGAA pLKO.1 1134 CDS 100% 4.050 2.835 N SLFN12 n/a
5 TRCN0000153520 CCTCGATGACTTAGAAAGAGA pLKO.1 1626 CDS 100% 3.000 2.100 N SLFN12 n/a
6 TRCN0000153033 GCTATCAGGAAGGATAACGTA pLKO.1 2007 CDS 100% 3.000 2.100 N SLFN12 n/a
7 TRCN0000152110 CACAGATATTGTTTGAGGGAT pLKO.1 2756 3UTR 100% 2.640 1.848 N SLFN12 n/a
8 TRCN0000153628 CCAGTTCATATGAAGAGGTGA pLKO.1 1904 CDS 100% 0.000 0.000 N SLFN12 n/a
9 TRCN0000151671 GCAACTTAATGTGATGTTGGA pLKO.1 2693 3UTR 100% 2.640 1.584 N SLFN12 n/a
10 TRCN0000167749 GCATTTCTAGTCAGTATGTAA pLKO.1 4834 3UTR 100% 5.625 2.813 Y DTWD2 n/a
11 TRCN0000151721 CGCAAGTAATTTACCCTGAAT pLKO.1 2399 CDS 100% 4.950 2.475 Y SLFN12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08470 pDONR223 100% 99.8% 99.6% None 129T>G;502T>C n/a
2 ccsbBroad304_08470 pLX_304 0% 99.8% 99.6% V5 129T>G;502T>C n/a
3 TRCN0000476272 TTCTATGGGACTCGTTTACGGAAC pLX_317 18.1% 99.8% 99.6% V5 129T>G;502T>C n/a
Download CSV