Transcript: Human XM_017024914.1

PREDICTED: Homo sapiens RAD51 paralog C (RAD51C), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAD51C (5889)
Length:
1204
CDS:
316..1095

Additional Resources:

NCBI RefSeq record:
XM_017024914.1
NBCI Gene record:
RAD51C (5889)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149745 GAAGCCTTAGAAACTCTGCAA pLKO.1 130 5UTR 100% 2.640 3.696 N RAD51C n/a
2 TRCN0000330045 AGCATACCCAGGGCTTCATAA pLKO_005 245 5UTR 100% 13.200 10.560 N RAD51C n/a
3 TRCN0000146298 CAGAAGAGAATGTCTCACAAA pLKO.1 156 5UTR 100% 4.950 3.465 N RAD51C n/a
4 TRCN0000330044 CAGAAGAGAATGTCTCACAAA pLKO_005 156 5UTR 100% 4.950 3.465 N RAD51C n/a
5 TRCN0000147658 GCTTCATAATCACCTTCTGTT pLKO.1 257 5UTR 100% 4.950 3.465 N RAD51C n/a
6 TRCN0000147369 GTTGGGATATCTAAAGCAGAA pLKO.1 112 5UTR 100% 4.050 2.835 N RAD51C n/a
7 TRCN0000330043 GTTGGGATATCTAAAGCAGAA pLKO_005 112 5UTR 100% 4.050 2.835 N RAD51C n/a
8 TRCN0000071261 CCAGGGCTTCATAATCACCTT pLKO.1 252 5UTR 100% 2.640 1.848 N Rad51c n/a
9 TRCN0000335778 CCAGGGCTTCATAATCACCTT pLKO_005 252 5UTR 100% 2.640 1.848 N Rad51c n/a
10 TRCN0000146467 CTGAGTCACACAAGAAGTGTA pLKO.1 200 5UTR 100% 4.950 2.970 N RAD51C n/a
11 TRCN0000348673 GATGACAACAAAGATTGATAA pLKO_005 819 CDS 100% 13.200 9.240 N Rad51c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.