Transcript: Human XM_017024956.1

PREDICTED: Homo sapiens tektin 3 (TEKT3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TEKT3 (64518)
Length:
3027
CDS:
188..937

Additional Resources:

NCBI RefSeq record:
XM_017024956.1
NBCI Gene record:
TEKT3 (64518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116662 CGCCTGATTCAAGACAAATAT pLKO.1 563 CDS 100% 15.000 21.000 N TEKT3 n/a
2 TRCN0000116665 CCGACATAATTCGGAGAAACT pLKO.1 526 CDS 100% 4.950 6.930 N TEKT3 n/a
3 TRCN0000414954 CACAGAGGGTGTCCGAGAATA pLKO_005 402 CDS 100% 13.200 9.240 N TEKT3 n/a
4 TRCN0000429067 GTAGCCCGAGAATGTCTATTT pLKO_005 767 CDS 100% 13.200 9.240 N TEKT3 n/a
5 TRCN0000116666 GCACTTACTGATGTGAAGAAA pLKO.1 704 CDS 100% 5.625 3.938 N TEKT3 n/a
6 TRCN0000116663 CCCACTCCAATTTGACCCATA pLKO.1 300 CDS 100% 4.050 2.835 N TEKT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08858 pDONR223 100% 49.1% 45.2% None (many diffs) n/a
2 ccsbBroad304_08858 pLX_304 0% 49.1% 45.2% V5 (many diffs) n/a
3 TRCN0000472027 GAAAGTGATAGAGCAAGGCCTCGG pLX_317 33.2% 49.1% 45.2% V5 (many diffs) n/a
Download CSV