Transcript: Human XM_017025030.1

PREDICTED: Homo sapiens calcium voltage-gated channel auxiliary subunit beta 1 (CACNB1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNB1 (782)
Length:
1563
CDS:
144..1211

Additional Resources:

NCBI RefSeq record:
XM_017025030.1
NBCI Gene record:
CACNB1 (782)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426597 TGATGCAGAAAGCTTTATTTG pLKO_005 883 CDS 100% 13.200 9.240 N CACNB1 n/a
2 TRCN0000428554 AGACCAAGCCAGTGGCATTTG pLKO_005 433 CDS 100% 10.800 7.560 N CACNB1 n/a
3 TRCN0000426319 AGAGGAAAGGGCGATTCAAAC pLKO_005 241 CDS 100% 10.800 7.560 N CACNB1 n/a
4 TRCN0000415077 TCCAGCAAATCAGGCGATAAC pLKO_005 690 CDS 100% 10.800 7.560 N CACNB1 n/a
5 TRCN0000069049 CCCAGCAAACACATCATCATT pLKO.1 993 CDS 100% 5.625 3.938 N Cacnb1 n/a
6 TRCN0000043791 CGTCCATCAGACTCTGATGTA pLKO.1 339 CDS 100% 0.495 0.347 N CACNB1 n/a
7 TRCN0000413544 GGACAAATGTTGGCTACAATC pLKO_005 460 CDS 100% 10.800 6.480 N Cacnb1 n/a
8 TRCN0000043790 CGGACAAATGTTGGCTACAAT pLKO.1 459 CDS 100% 5.625 3.375 N CACNB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10707 pDONR223 100% 58.1% 57.3% None (many diffs) n/a
2 ccsbBroad304_10707 pLX_304 0% 58.1% 57.3% V5 (many diffs) n/a
3 TRCN0000466734 CGCCCTGATTCCAAAGGCTGCATG pLX_317 22% 58.1% 57.3% V5 (many diffs) n/a
Download CSV