Transcript: Human XM_017025175.1

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily H member 6 (KCNH6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNH6 (81033)
Length:
3149
CDS:
81..3065

Additional Resources:

NCBI RefSeq record:
XM_017025175.1
NBCI Gene record:
KCNH6 (81033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019840 GCCCTACCTAGAACACAAGAT pLKO.1 1361 CDS 100% 4.950 6.930 N KCNH6 n/a
2 TRCN0000019843 CGAGGGCCAAAGTCGGAAGTT pLKO.1 146 CDS 100% 1.650 2.310 N KCNH6 n/a
3 TRCN0000420762 CCACTGAACTCCAAGATAAAG pLKO_005 3059 CDS 100% 13.200 9.240 N KCNH6 n/a
4 TRCN0000019839 CCTGGAAGTACAAGGACTCAT pLKO.1 2933 CDS 100% 4.950 3.465 N KCNH6 n/a
5 TRCN0000019841 CGTGGAGTTCAACTTGGAGAA pLKO.1 644 CDS 100% 4.050 2.835 N KCNH6 n/a
6 TRCN0000019842 CCAAGCTATGGAGACTTGGAT pLKO.1 2775 CDS 100% 0.300 0.210 N KCNH6 n/a
7 TRCN0000442901 GCCTGAGCTACTGCAGGAAAT pLKO_005 2465 CDS 100% 10.800 6.480 N KCNH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14289 pDONR223 100% 50.3% 50.2% None (many diffs) n/a
2 ccsbBroad304_14289 pLX_304 0% 50.3% 50.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468367 GATACGGCATTCACCCGCCGGGGG pLX_317 29% 50.3% 50.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV