Transcript: Human XM_017025184.1

PREDICTED: Homo sapiens nudE neurodevelopment protein 1 like 1 (NDEL1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDEL1 (81565)
Length:
2564
CDS:
348..1424

Additional Resources:

NCBI RefSeq record:
XM_017025184.1
NBCI Gene record:
NDEL1 (81565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197869 GCGATATCAATACTGGCTATT pLKO.1 1601 3UTR 100% 10.800 15.120 N Ndel1 n/a
2 TRCN0000353681 GGGTCGCAAGGTGATACATAC pLKO_005 1670 3UTR 100% 10.800 15.120 N NDEL1 n/a
3 TRCN0000136911 CGTCCTTCAGTTCAACGACAT pLKO.1 2157 3UTR 100% 4.050 5.670 N NDEL1 n/a
4 TRCN0000330531 AGTCAGACTCGGGCCATTAAG pLKO_005 690 CDS 100% 13.200 10.560 N NDEL1 n/a
5 TRCN0000176500 CTTTCCTTGAAGTATAAGCAA pLKO.1 450 CDS 100% 3.000 2.400 N Ndel1 n/a
6 TRCN0000330533 ATATGAAGTGGAGGCATTAAA pLKO_005 605 CDS 100% 15.000 10.500 N NDEL1 n/a
7 TRCN0000135284 CCTTCAGTTCAACGACATCTT pLKO.1 2160 3UTR 100% 4.950 3.465 N NDEL1 n/a
8 TRCN0000136925 CGGGAAAGACAACAGGAAGTA pLKO.1 936 CDS 100% 4.950 3.465 N NDEL1 n/a
9 TRCN0000134612 GCATCCTTTGATTACTCTCAT pLKO.1 2302 3UTR 100% 4.950 3.465 N NDEL1 n/a
10 TRCN0000135136 CCGAAAGCTATACCAAATGGT pLKO.1 1080 CDS 100% 3.000 2.100 N NDEL1 n/a
11 TRCN0000330473 CCGAAAGCTATACCAAATGGT pLKO_005 1080 CDS 100% 3.000 2.100 N NDEL1 n/a
12 TRCN0000330532 CAGAGTTGGAGGCACAATTAG pLKO_005 532 CDS 100% 13.200 7.920 N NDEL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09072 pDONR223 100% 96% 96% None (many diffs) n/a
2 ccsbBroad304_09072 pLX_304 0% 96% 96% V5 (many diffs) n/a
3 TRCN0000492231 GGCGTTCTGCTTGCGCATATTTCC pLX_317 40.2% 96% 96% V5 (many diffs) n/a
Download CSV